Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circRNA_102594/hsa_circ_0052012 | |||
Gene | POLD1 | Organism | Human |
Genome Locus | chr19:50902107-50902741:+ | Build | hg19 |
Disease | Rheumatoid Arthritis | ICD-10 | Rheumatoid arthritis, unspecified (M06.9) |
DBLink | Link to database | PMID | 28983619 |
Experimental Method | |||
Sample Type | Peripheral Blood Mononuclear Cells (PBMCs) | Comparison | Totally twenty RA patients and healthy people |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward CACCATCAGCCATAGATCCTC ReverseCTTGCCATCCATCCCACATA | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Zheng, F, Yu, X, Huang, J, Dai, Y (2017). Circular RNA expression profiles of peripheral blood mononuclear cells in rheumatoid arthritis patients, based on microarray chip technology. Mol Med Rep, 16, 6:8029-8036. |